Annotations: 1KX5

Domain Annotation: SCOP/SCOPe Classification SCOP-e Database Homepage

Chains	Domain Info	Class	Fold	Superfamily	Family	Domain	Species	Provenance Source (Version)
C [auth A]	d1kx5a_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H3	African clawed frog (Xenopus laevis ) [TaxId: 8355 ],	SCOPe (2.08)
G [auth E]	d1kx5e_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H3	African clawed frog (Xenopus laevis ) [TaxId: 8355 ],	SCOPe (2.08)
D [auth B]	d1kx5b_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H4	African clawed frog (Xenopus laevis ) [TaxId: 8355 ],	SCOPe (2.08)
H [auth F]	d1kx5f_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H4	African clawed frog (Xenopus laevis ) [TaxId: 8355 ],	SCOPe (2.08)
I [auth G]	d1kx5g_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H2A	African clawed frog (Xenopus laevis ) [TaxId: 8355 ],	SCOPe (2.08)
E [auth C]	d1kx5c_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H2A	African clawed frog (Xenopus laevis ) [TaxId: 8355 ],	SCOPe (2.08)
F [auth D]	d1kx5d_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H2B	African clawed frog (Xenopus laevis ) [TaxId: 8355 ],	SCOPe (2.08)
J [auth H]	d1kx5h_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H2B	African clawed frog (Xenopus laevis ) [TaxId: 8355 ],	SCOPe (2.08)

Domain Annotation: SCOP2 Classification SCOP2 Database Homepage

Chains	Type	Family Name	Domain Identifier	Family Identifier	Provenance Source (Version)
C [auth A]	SCOP2B Superfamily	Core histone-like	8041272	3001387	SCOP2B (2022-06-29)
G [auth E]	SCOP2B Superfamily	Core histone-like	8041272	3001387	SCOP2B (2022-06-29)
D [auth B]	SCOP2B Superfamily	Core histone-like	8042439	3001387	SCOP2B (2022-06-29)
H [auth F]	SCOP2B Superfamily	Core histone-like	8042439	3001387	SCOP2B (2022-06-29)
I [auth G]	SCOP2B Superfamily	Core histone-like	8041278	3001387	SCOP2B (2022-06-29)
E [auth C]	SCOP2B Superfamily	Core histone-like	8041278	3001387	SCOP2B (2022-06-29)
F [auth D]	SCOP2B Superfamily	Core histone-like	8041279	3001387	SCOP2B (2022-06-29)
J [auth H]	SCOP2B Superfamily	Core histone-like	8041279	3001387	SCOP2B (2022-06-29)

Domain Annotation: ECOD Classification ECOD Database Homepage

Chains	Family Name	Domain Identifier	Architecture	Possible Homology	Homology	Topology	Family	Provenance Source (Version)
C [auth A]	Histone	e1kx5A1	A: alpha arrays	X: Histone-like	H: Histone-related	T: Histone	F: Histone	ECOD (1.6)
G [auth E]	Histone	e1kx5E1	A: alpha arrays	X: Histone-like	H: Histone-related	T: Histone	F: Histone	ECOD (1.6)
D [auth B]	Histone_1	e1kx5B1	A: alpha arrays	X: Histone-like	H: Histone-related	T: Histone	F: Histone_1	ECOD (1.6)
H [auth F]	Histone_1	e1kx5F1	A: alpha arrays	X: Histone-like	H: Histone-related	T: Histone	F: Histone_1	ECOD (1.6)
I [auth G]	Histone_1	e1kx5G1	A: alpha arrays	X: Histone-like	H: Histone-related	T: Histone	F: Histone_1	ECOD (1.6)
E [auth C]	Histone_1	e1kx5C1	A: alpha arrays	X: Histone-like	H: Histone-related	T: Histone	F: Histone_1	ECOD (1.6)
F [auth D]	Histone	e1kx5D1	A: alpha arrays	X: Histone-like	H: Histone-related	T: Histone	F: Histone	ECOD (1.6)
J [auth H]	Histone	e1kx5H1	A: alpha arrays	X: Histone-like	H: Histone-related	T: Histone	F: Histone	ECOD (1.6)

Domain Annotation: CATH CATH Database Homepage

Chain	Domain	Class	Architecture	Topology	Homology	Provenance Source (Version)
C [auth A]	1.10.20.10	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A	CATH (4.3.0)
G [auth E]	1.10.20.10	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A	CATH (4.3.0)
D [auth B]	1.10.20.10	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A	CATH (4.3.0)
H [auth F]	1.10.20.10	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A	CATH (4.3.0)
I [auth G]	1.10.20.10	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A	CATH (4.3.0)
E [auth C]	1.10.20.10	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A	CATH (4.3.0)
F [auth D]	1.10.20.10	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A	CATH (4.3.0)
J [auth H]	1.10.20.10	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A	CATH (4.3.0)

Protein Family Annotation Pfam Database Homepage

Chains	Accession	Name	Description	Comments	Source
C [auth A], G [auth E]	PF00125	Core histone H2A/H2B/H3/H4 (Histone)	Core histone H2A/H2B/H3/H4	-	Domain
D [auth B], H [auth F]	PF15511	Centromere kinetochore component CENP-T histone fold (CENP-T_C)	Centromere kinetochore component CENP-T histone fold	CENP-T is a family of vertebral kinetochore proteins that associates directly with CENP-W. The N-terminus of CENP-T proteins interacts directly with the Ndc80 complex in the outer kinetochore. Importantly, the CENP-T-W complex does not directly asso ...	CENP-T is a family of vertebral kinetochore proteins that associates directly with CENP-W. The N-terminus of CENP-T proteins interacts directly with the Ndc80 complex in the outer kinetochore. Importantly, the CENP-T-W complex does not directly associate with CENP-A, but with histone H3 in the centromere region. CENP-T and -W form a hetero-tetramer with CENP-S and -X and bind to a ~100 bp region of nucleosome-free DNA forming a nucleosome-like structure. The DNA-CENP-T-W-S-X complex is likely to be associated with histone H3-containing nucleosomes rather than with CENP-nucleosomes. This domain is the C-terminal histone fold domain of CENP-T, which associates with chromatin [2-3].	Domain
E [auth C], I [auth G]	PF16211	C-terminus of histone H2A (Histone_H2A_C)	C-terminus of histone H2A	-	Family
E [auth C], I [auth G]	PF00125	Core histone H2A/H2B/H3/H4 (Histone)	Core histone H2A/H2B/H3/H4	-	Domain

Gene Ontology: Gene Product Annotation Gene Ontology Database Homepage

Chains	Polymer	Molecular Function	Biological Process	Cellular Component
A [auth I]	DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')	-	-	-
B [auth J]	DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3')	-	-	-
C [auth A], G [auth E]	histone H3	DNA binding binding organic cyclic compound binding nucleic acid binding protein heterodimerization activity protein binding protein dimerization activity structural molecule activity structural constituent of chromatin	-	protein-containing complex intracellular anatomical structure protein-DNA complex nucleosome intracellular membraneless organelle chromatin chromosome intracellular organelle cellular anatomical structure organelle membraneless organelle membrane-bounded organelle nucleus membrane-enclosed lumen protein-containing complex intracellular anatomical structure protein-DNA complex nucleosome intracellular membraneless organelle chromatin chromosome intracellular organelle cellular anatomical structure organelle membraneless organelle membrane-bounded organelle nucleus membrane-enclosed lumen intracellular membrane-bounded organelle intracellular organelle lumen nucleoplasm organelle lumen nuclear lumen
D [auth B], H [auth F]	histone H4	DNA binding binding organic cyclic compound binding nucleic acid binding protein heterodimerization activity protein binding protein dimerization activity structural molecule activity structural constituent of chromatin	protein-containing complex organization protein-DNA complex assembly cellular component organization protein-DNA complex organization cellular component biogenesis cellular component assembly chromatin organization protein-containing complex assembly chromatin remodeling cellular process cellular component organization or biogenesis nucleosome assembly nucleosome organization	protein-containing complex intracellular anatomical structure protein-DNA complex nucleosome intracellular membraneless organelle chromatin chromosome intracellular organelle cellular anatomical structure organelle membraneless organelle membrane-bounded organelle nucleus intracellular membrane-bounded organelle
E [auth C], I [auth G]	histone H2A.1	DNA binding binding organic cyclic compound binding nucleic acid binding protein heterodimerization activity protein binding protein dimerization activity structural molecule activity structural constituent of chromatin	-	protein-containing complex intracellular anatomical structure protein-DNA complex nucleosome intracellular membraneless organelle chromatin chromosome intracellular organelle cellular anatomical structure organelle membraneless organelle membrane-bounded organelle nucleus intracellular membrane-bounded organelle
F [auth D], J [auth H]	histone H2B.2	DNA binding binding organic cyclic compound binding nucleic acid binding protein heterodimerization activity protein binding protein dimerization activity structural molecule activity structural constituent of chromatin	-	protein-containing complex intracellular anatomical structure protein-DNA complex nucleosome intracellular membraneless organelle chromatin chromosome intracellular organelle cellular anatomical structure organelle membraneless organelle membrane-bounded organelle nucleus intracellular membrane-bounded organelle

InterPro: Protein Family Classification InterPro Database Homepage

Chains	Accession	Name	Type
C [auth A], G [auth E]	IPR009072	Histone-fold	Homologous Superfamily
C [auth A], G [auth E]	IPR007125	Histone H2A/H2B/H3	Domain
C [auth A], G [auth E]	IPR000164	Histone H3/CENP-A	Family
D [auth B], H [auth F]	IPR009072	Histone-fold	Homologous Superfamily
D [auth B], H [auth F]	IPR001951	Histone H4	Family
D [auth B], H [auth F]	IPR035425	CENP-T/Histone H4, histone fold	Domain
D [auth B], H [auth F]	IPR019809	Histone H4, conserved site	Conserved Site
D [auth B], H [auth F]	IPR004823	TATA box binding protein associated factor (TAF), histone-like fold domain	Domain
E [auth C], I [auth G]	IPR009072	Histone-fold	Homologous Superfamily
E [auth C], I [auth G]	IPR007125	Histone H2A/H2B/H3	Domain
E [auth C], I [auth G]	IPR002119	Histone H2A	Family
E [auth C], I [auth G]	IPR032454	Histone H2A, C-terminal domain	Domain
E [auth C], I [auth G]	IPR032458	Histone H2A conserved site	Conserved Site
F [auth D], J [auth H]	IPR009072	Histone-fold	Homologous Superfamily
F [auth D], J [auth H]	IPR007125	Histone H2A/H2B/H3	Domain
F [auth D], J [auth H]	IPR000558	Histone H2B	Family

RCSB PDB Core Operations are funded by the U.S. National Science Foundation (DBI-2321666), the US Department of Energy (DE-SC0019749), and the National Cancer Institute, National Institute of Allergy and Infectious Diseases, and National Institute of General Medical Sciences of the National Institutes of Health under grant R01GM157729.